Phenotypic and genotypic analysis of heterotrophic bacteria and nitrogen-fixing in sediment in the basin of the Cuiaba River – MT

Description
Sediments are complex systems that are affected by geological, hydrodynamic, chemical and biological parameters, as determined by interactions between the sedimentary environments of each region. This study aimed to characterize the diversity of

Please download to get full document.

View again

of 15
All materials on our website are shared by users. If you have any questions about copyright issues, please report us to resolve them. We are always happy to assist you.
Information
Category:

Religion & Spirituality

Publish on:

Views: 32 | Pages: 15

Extension: PDF | Download: 0

Share
Tags
Transcript
    Ambiente & Água -   An Interdisciplinary Journal of Applied Science  ISSN 1980-993X  –  doi:10.4136/1980-993X www.ambi-agua.net E-mail: ambi-agua@agro.unitau.br Rev. Ambient. Água  vol. 9 n. 1 Taubaté - Jan. / Mar. 2014 Análise fenotípica e genotípica de bactérias heterotróficas e fixadoras de nitrogênio em sedimento na bacia do Rio Cuiabá-MT doi: 10.4136/ambi-agua.1207 Received: 30 Sep. 2013; Accepted: 27 Feb. 2014 Fernanda Viana da Cunha * ; Selma Baia Batista Universidade Federal de Mato Grosso (UFMT)  –   Cuiabá, MT, Brasil Programa de Pós-Graduação em Recursos Hídricos * Autor correspondente: e-mail: fernanda.vianacunha@gmail.com, selfa@bol.com.br RESUMO Os sedimentos apresentam-se como um sistema complexo, que são afetados por  parâmetros geológicos, hidrodinâmicos, químicos e biológicos, caracterizado por uma interação entre o ambiente sedimentar de cada região. O presente estudo consistiu em caracterizar a diversidade de bactérias heterotróficas totais e fixadores de nitrogênio em sedimentos do rio Cuiabá utilizando técnicas convencionais de microbiologia e de biologia molecular. As amostras de sedimento foram coletadas com periodicidade bimestral, em quatro  pontos sendo estes: Cuiabazinho, Passagem da Conceição, Ribeirão dos Cocais e Barão de Melgaço. As amostras foram processadas através de diluições seriadas (10 -2 a 10 -7 ) em solução salina 0,85%. Em seguida cultivadas em placa de Petri através da técnica de Spreed Plate, em meio de cultivo Trypic Soy Agar (TSA) para bactérias heterotróficas totais e para  bactérias nitrificantes foram utilizados meios seletivos (NFB, JMV e Meio 79) incubadas a 35°C. Posteriormente as estirpes bacterianas foram reisoladas em Agar Nutriente (AN) a fim de obter cultura pura para análise morfotintorial de Gram. Este teste permitiu verificar que dos 202 isolados bacterianos, 59% eram bastonetes positivos, sendo que, a maior quantificação  bacteriana obtida foi no meio de cultivo TSA, comparado aos outros meios de cultura. O  perfil da comunidade bacteriana apresentou na sua maioria bactérias da família Bacillaceae com 28%, sendo que as mesmas foram utilizadas para a análise molecular por Box-PCR, que apresentou uma riqueza de espécies. Esses resultados indicam a importância de pesquisas sobre diversidade microbiana de sedimentos no Estado de Mato Grosso que utilizam técnicas moleculares. Palavras-chave: autodepuração, biologia molecular, Box-PCR. Phenotypic and genotypic analysis of heterotrophic bacteria and nitrogen-fixing in sediment in the basin of the Cuiaba River  –   MT ABSTRACT Sediments are complex systems that are affected by geological, hydrodynamic, chemical and biological parameters, as determined by interactions between the sedimentary environments of each region. This study aimed to characterize the diversity of total heterotrophic bacteria and nitrogen fixers in Cuiabá River sediments using conventional   69 Análise fenotípica e genotípica de bactérias heterotróficas …   Rev. Ambient. Água  vol. 9 n. 1 Taubaté - Jan. / Mar. 2014 techniques of microbiology and molecular biology. Sediment samples were collected  bimonthly from four points: Cuiabazinho, Passagem da Conceição, Ribeirão Cocais and Barão de Melgaço. The samples were processed in serial dilutions (10 -2  to 10 -7 ) in 0.85% saline solution. They were then cultured in Petri dishes using the Spread Plate technique in the Trypic Soy Agar (TSA) culture medium for total heterotrophic bacteria and selective medium (NFB, JMV and culture median 79) incubated at 35°C for nitrifying bacteria. The bacterial strains were then re-isolated on Nutrient Agar (NA) in order to obtain a pure culture for the Gram analysis morphotypes. This test revealed that, of the 202 bacterial isolates, 59 % were  positive rods. The largest bacterial count was obtained in the TSA medium, as compared to other means of culture. The profile of the bacterial community showed that most, or 28 %, of the bacteria were of the Bacillaceae family and these were used for molecular analysis using Box-PCR, which showed a great diversity of species. These results indicate the importance of microbial diversity research in sediments in Mato Grosso State using molecular techniques.   Keywords : Box-PCR, micro-organisms, self-depuration.  1. INTRODUÇÃO A bacia hidrográfica do rio Cuiabá é tributária do rio Paraguai na parte superior do seu curso, e por isso é considerada uma sub-bacia do rio Paraguai, e está localizada na região Centro-Oeste, englobando parte de Mato Grosso e uma pequena porção do norte de Mato Grosso do Sul. Este também banha a planície Pantaneira, extravasando suas águas para fora do leito no período de cheia, inundando campos e lagoas, contribuindo para formar uma das maiores áreas alagáveis contínuas e também uma das áreas referências em biodiversidade no mundo (Cuiabá, 2005). É comum verificar no Estado de Mato Grosso a ocupação de cabeceiras de drenagem,  principalmente pela agricultura, e a destruição da mata ciliar, situações essas que tornam os recursos hídricos extremamente vulneráveis à contaminação, onde no trecho médio da bacia, altamente urbanizado e industrializado, a principal preocupação é o esgoto doméstico, o qual é responsável por cerca de 80% da carga orgânica no rio, sendo os restantes 20% resultantes da atividade agro-industrial (Shinma, 2004; Calheiros, 2008). Porém, a situação ambiental e hídrica da bacia do rio Cuiabá não resulta apenas da ocupação humana, mas também das próprias características topográficas da região (ANA, 2003), e que pode ser afetada pela sedimentação e alterações dos padrões de ocupação do solo no trecho superior da bacia, uma vez que, os solos arenosos e a topografia acidentada desta região produzem elevadas taxas de sedimentação no rio (Shinma, 2004). Os ambientes aquáticos são fundamentais para o estabelecimento de muitos grupos de organismos no planeta, sendo assim, a disponibilidade e a boa qualidade destes ambientes é essencial para a manutenção da biodiversidade aquática (Odum, 2007). Segundo Begon et al. (2006), um dos aspectos ecológicos mais impressionantes dos micro-organismos é a sua ubiqüidade, sendo filogeneticamente relacionados, em diferentes proporções, ocorrendo em sincronia no tempo e no espaço, e realizando diversas funções, as bactérias podem representar mais de 90 % desses micro-organismos. As bactérias heterotróficas desempenham papel importante no estudo dos impactos ambientais, bem como nos sedimentos, sendo considerado um componente importante da comunidade biótica no ecossistema (Gimenes et al., 2010). Estes podem estar associados à  produção e o consumo da matéria orgânica e ainda controlar a ciclagem do nitrogênio desempenhando um papel importante nesse processo (Carvalho e Paranhos, 2010). Dessa maneira, o conhecimento da diversidade microbiana é essencial para entender a relação entre os parâmetros ambientais e o funcionamento dos ecossistemas, e isso pode ser possível com o   70 Fernanda Viana da Cunha et al. Rev. Ambient. Água  vol. 9 n. 1 Taubaté  –   Jan. / Mar. 2014 avanço da biologia molecular e o uso de novas técnicas no estudo da ecologia desses micro-organismos, que permite conhecer sua diversidade e distribuição (Carvalho e Paranhos, 2010). Como alternativa existem diversos métodos moleculares disponíveis baseados na manipulação dos ácidos nucléicos seja o ácido desoxirribonucléico (DNA) ou o ácido ribonucléico (RNA) que podem ser extraídos de estirpes crescidas em meios de cultura ou até mesmo a partir de amostras diretamente do ambiente, em que se pode citar a PCR, e suas variações, RFLP- PCR, RT-PCR, Nested-PCR, Rep-PCR (REP, ERIC, BOX), PCR em tempo real, e DGGE, Sequenciamento, entre outros (Reis Jr. et al., 2002; Eça, 2004). O presente estudo consiste em caracterizar a diversidade de bactérias heterotróficas e fixadores de nitrogênio em sedimentos do rio Cuiabá utilizando uma abordagem polifásica de microbiologia convencional e molecular. 2. MATERIAL E MÉTODOS 2.1. Área de estudo O estudo foi realizado na bacia do Rio Cuiabá, que se encontra localizada entre as coordenadas geográficas 14º18’ e 17º00’ de latitude Sul e 54º40’ e 56º55’ de longitude Oeste, o Rio Cuiabá, que drena uma área aproximada de 21.730 km 2  até a cidade de Cuiabá, sendo este um dos principais afluentes do Rio Paraguai (Cuiabá, 2005).  2.2. Delineamento amostral Foram realizadas seis coletas, sendo a primeira em Julho de 2011 e a última em Maio de 2012, com periodicidade bimestral, contemplando um ciclo anual durante os períodos de seca (maio, julho e setembro) e chuva (novembro, janeiro e março) em quatro pontos amostrais, iniciando-se na nascente da cabeceira da bacia do Rio Cuiabá até a jusante da cidade de Barão de Melgaço. Os pontos escolhidos podem ser observados na Figura 1. P1  –   Cuiabazinho (próximo à área de nascente); P4  –   Passagem da Conceição; P6  –   Jusante do Córrego Ribeirão dos Cocais (avaliando a influência do Rio Coxipó); P8  –   Jusante de Barão de Melgaço. Amostras de sedimento, foram constituída por sub-amostras com distribuição aleatória, realizadas com um amostrador do tipo raspador de fundo, sendo impossível representar  profundidade devido ao amostrador ser do tipo raspador. Assim, em cada ponto amostral foram realizadas três coletas A, B e C o qual cada uma delas foi composta de três amostras simples (Costa, 2001). 2.3. Análise física e química As análises de textura do sedimento empregado para designar a proporção relativa das frações argila, silte ou areia, que se diferenciam entre si pelo tamanho de suas partículas (granulometria). Para a dispersão das amostras de sedimento foram adicionados 25 gramas de solo peneirados em frascos, nestes foram colocados 50 ml de água destilada; 10 ml de NaOH a 6 %; em agitação em mesa agitadora por 16 horas. Em seguida completou o volume da  proveta até 1000 ml com água destilada este conteúdo com agitador manual por 30 vezes, a leitura da fração de areia e argila foi realizada pela técnica do densímetro de Bouyoucos, e a fração silte foi calculada por diferença (EMBRAPA, 1979). As análises foram realizadas no laboratório de Física do Solo no Departamento de Engenharia Florestal da Universidade Federal de Mato Grosso, FAMEV.   71 Análise fenotípica e genotípica de bactérias heterotróficas …   Rev. Ambient. Água  vol. 9 n. 1 Taubaté - Jan. / Mar. 2014 Figura 1 . Localização das estações de amostragem de sedimento no rio Cuiabá. 6.4.2. ANÁLISE QUÍMICA A concentração dos elementos químicos fósforo (P), potássio (K), matéria orgânica e  potencial hidrogeniônico (pH) das amostras foi determinada segundo as recomendações de EMBRAPA (1997).   As análises foram realizadas no laboratório de Fertilidade do Solo no Departamento de Engenharia Florestal da Universidade Federal de Mato Grosso, FAMEV. 2.4. Processamento e quantificação bacteriana Para a quantificação bacteriana foram pesados 5 g de sedimento e adicionado em um Erlenmeyer contendo 45 mL de solução extratora adicionado de 1 % de Tween 80 e 1 % de  pirofosfato de sódio, após etapa de agitação em mesa orbital a 220 rpm por 30 minutos em temperatura ambiente. Após a homogeneização das amostras, foram retiradas uma alíquota de 1 mL desse material para iniciar as diluições seriadas necessárias para o processamento das amostras.As diluições (10 -2 a10 -6 ) foram feitas em tubos de ensaio contendo 9 mL de solução salina (0,85% NaCl) estéril (Neder, 1992). Para a quantificação de bactérias heterotróficas totais, foram inoculado 100 µL das diluições 10 -4  a 10 -6 , em triplicata, adicionado em meio TrypicSoy Agar (TSA), acrescentado de 0,04 g L -1  de ciclohexamida (fungicida), e para as  bactérias fixadoras de nitrogênio foi realizado o mesmo processo citado acima, porém, inoculado em meios específicos e seletivos, que foram o meio NFB, JMV e Meio 79 segundo Döbereiner et al. (1999), e utilizando a técnica de Spread plate, as mesmas foram incubadas em estufa de crescimento por 35°C por 144 h. Após a verificação do crescimento, foram realizadas contagens de unidades formadoras de colônia (UFC’s)  pelo método de Contagem Padrão em Placas (CPP) (Tortora et al., 2012).O número de colônias foi multiplicado pelo inverso do fator de diluição para obtenção do valor de UFC·mL -1  de amostra e os valores expressos em Log de UFC g -1  de sedimento (Tortora et al., 2012).  2.5. Caracterização Fenotípica  Após a análise morfotintorial de Gram, foram realizados teste fisiológico e bioquímicas  para todas as cepas selecionadas, a fim de caracterizar as estirpes fenotipicamente, uma prova a mais na identificação das bactérias isoladas. Os testes realizados foram; redução do nitrato,   72 Fernanda Viana da Cunha et al. Rev. Ambient. Água  vol. 9 n. 1 Taubaté  –   Jan. / Mar. 2014 teste da catalase, teste de oxidação/fermentação de glicose e teste de Oxidase, e teste de motilidade segundo MacFaddin (1980). 2.6. Análise estatística Os tratamentos estatísticos envolveram a análise descritiva para identificação de valores discrepantes, utilizando o teste não paramétrico de  Kruskal-Wallis , pelo Software Statistica  7.0.   2.7. Caracterização  genotípica - BOX-PCR Para a extração do material genômico foi utilizado kit Genomic  DNA  fromTissueNucleoSpin ® seguindo as instruções do fabricante. Os fragmentos foram visualizados pela eletroforese em gel de agarose (Invitrogen) 0,5% a 100 Volts por 30 minutos; o gel foi corado com brometo de etídio e foi usado um padrão de  peso molecular 100 pb e foi visualizada em um transluminador de luz UltraVioleta (254nm). A avaliação da diversidade genética dos isolados bacterianos foi realizada usando a técnica Box-PCR, utilizando o  primer Box- 1AR (‘5CTACGGCAAGGCGACGCTGACG - 3’) (Versalovic et al., 1994). A reação de amplificação foi realizada com os seguintes volumes: 12,5 µl de GoTaq ® . A amplificação foi realizada usando os seguintes ciclos: um ciclo de desnaturação inicial a 95°C por 7 min; 35 ciclos de desnaturação (1 min a 94°C), anelamento (1 min a 53°C) e extensão (8 min a 65°C); um ciclo de extensão final a 65°C por 16 min; manutenção a 4°C. Os fragmentos amplificados foram separados por eletroforese a 100 V em gel de agarose a 2%em tampão TAE 0,5 X. Após seis horas de corrida, o gel foi corado em  brometo de etídeo e os fragmentos amplificados foram visualizados em transluminador UV (254 nm), assim como o produto da extração, para os amplificados também foi usado opadrão de peso molecular 100 pb. O perfil de bandas geradas pela amplificação foram transformadas em dados binários (presença e ausência de bandas), e em seguida utilizadas para obter um dendrograma de similaridade calculado pelo coeficiente de Jaccard e agrupado utilizando o algoritmo UPGMA (UnweightedPair-GroupMethodwithArithmeticalAverage),  utilizando o  software Bionumerics  7.0 (AppliedMathematics, Kortrijk, Bélgica).   3. RESULTADOS E DISCUSSÃO 3.1. Análise física e química A análise física por granulometria, para o teor de argila, silte e areia, nos pontos P1, P4, P6 e P8, da bacia do Rio Cuiabá, teve grande concentração de areia em todos os períodos de coleta, principalmente no Ponto P4 (Passagem da Conceição), localizado em um perímetro urbano, ponto muito conhecido por ser utilizado por banhista (ANA, 2011). Todas as amostras apresentaram pH em torno cinco (5.0), essa acidez do sedimento pode ser devido as características do solo, que em sua maioria é lixiviado para a bacia. Como os solos da região são conhecidos por serem ácidos e de baixa fertilidade, necessitam de técnicas de calagem e adubação (Pereira et al., 1999). Os resultados das análises químicas do sedimento para fósforo (P), potássio (K) e matéria orgânica (MO), e pH, foram caracterizados como sendo de maior relevância para o estudo  proposto (Tabela 1).
Related Search
Similar documents
View more...
We Need Your Support
Thank you for visiting our website and your interest in our free products and services. We are nonprofit website to share and download documents. To the running of this website, we need your help to support us.

Thanks to everyone for your continued support.

No, Thanks